View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19270_low_36 (Length: 254)
Name: NF19270_low_36
Description: NF19270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19270_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 60; Significance: 1e-25; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 142 - 229
Target Start/End: Original strand, 34332511 - 34332598
Alignment:
| Q |
142 |
gtagtagtttttaaccttcatttaggttaagtaaaaaagaaagagtaattggcttaaacccaaattataatatgacattaaagtttat |
229 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||||| ||| |||||| |||||||||||||| |||||||||||| |
|
|
| T |
34332511 |
gtagtagtttttaagattgatttaggttaagtaaaaaagaaagagtaataggcataaaccgaaattataatatgatattaaagtttat |
34332598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 34331978 - 34332047
Alignment:
| Q |
1 |
ccattttgtatggaccccgagtcctatgtacggtcacatcctcaaatgatcatgccttttttgtgtgaaa |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
34331978 |
ccattttgtatggaccccgagtcctatgtacggtcacatctccaaatgatcatgccttttttgtgggaaa |
34332047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 66 - 114
Target Start/End: Original strand, 34332176 - 34332224
Alignment:
| Q |
66 |
tgaaaatttatttataaataattttaaatgtgtaggagatattccttat |
114 |
Q |
| |
|
||||||| |||||||||||||||||||||||| | ||||||||| |||| |
|
|
| T |
34332176 |
tgaaaatgtatttataaataattttaaatgtgcatgagatattcattat |
34332224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University