View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19270_low_38 (Length: 250)
Name: NF19270_low_38
Description: NF19270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19270_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 76 - 237
Target Start/End: Original strand, 40466294 - 40466455
Alignment:
| Q |
76 |
aacctttgatatgtgtggttgatggtgtataagcacggttatatggtatatataaaggcaaaaataagcataaagtttgaactcgtatttaccacatcat |
175 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40466294 |
aacctttgatatgagtggttgatggtgtataagcacggttatatggtatatataaaggcaaaaataagcataaagtttgaactcgtatttaccacatcat |
40466393 |
T |
 |
| Q |
176 |
taaaatgatgctgactcgtctatagggaaccaaggaaaacttgatccaatgtcttatctgtg |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40466394 |
taaaatgatgctgactcgtctatagggaaccaaggaaaacttgatccaatgtcttatctgtg |
40466455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University