View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19270_low_49 (Length: 222)
Name: NF19270_low_49
Description: NF19270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19270_low_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 17 - 67
Target Start/End: Original strand, 22348593 - 22348643
Alignment:
| Q |
17 |
caaaggacaatcagcgtcactgacacatcgaatttcaagtactgcaatgtc |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
22348593 |
caaaggacaatcagcgtcactgacacatcgaatttcaagttctgcaatgtc |
22348643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 136 - 170
Target Start/End: Original strand, 22348712 - 22348746
Alignment:
| Q |
136 |
gaaatagtatgacaaatgacataccaccattggtt |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
22348712 |
gaaatagtatgacaaatgacataccaccattggtt |
22348746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University