View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19270_low_50 (Length: 218)
Name: NF19270_low_50
Description: NF19270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19270_low_50 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 15 - 199
Target Start/End: Original strand, 7958380 - 7958561
Alignment:
| Q |
15 |
cagagagtagtatcttgggtcaagaaacaagtttactcaaaagaaaacctgttaatgcttcatcaactcgctctgcatcatgttctgggaaatcatccaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7958380 |
cagagagtagtatcttgggtcaagaaacaagtttactcaaaagaaaacctgttaatgcttcatcaactcgctctgcatcatgttctgggaaatcatccaa |
7958479 |
T |
 |
| Q |
115 |
cggtggaggaaactgcacatcatcatcatcatcttcaagaggaatgcagtttaggaagctatctggatgttatgaatgtcacatg |
199 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7958480 |
cggtggaggaaactaca---catcatcatcatcttcaagaggaatgcagtttaggaagctatctggatgttatgaatgtcacatg |
7958561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University