View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19270_low_52 (Length: 211)
Name: NF19270_low_52
Description: NF19270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19270_low_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 18 - 195
Target Start/End: Original strand, 42003645 - 42003832
Alignment:
| Q |
18 |
acgtctcaatggtcttgccacctaccaattgattacgagactagatttaaatcgatagttatgatttttgttttgaaacgtagtggttaggttaatattt |
117 |
Q |
| |
|
|||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42003645 |
acgtcttaacggtcttgccacttaccaattgattacgagactagatttaaatcgatagttatgatttttgttttgaaacgtagtggttaggttaatattt |
42003744 |
T |
 |
| Q |
118 |
----------gataatttgaatctggtctttcaactctttattattagttcaaactagttgaattacttaacacatttaatcgttctt |
195 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42003745 |
tctattttaccataatttgaatctaatctttcaactctttattattagttcaaaccagttgaattacttaacacatttaatcgttctt |
42003832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University