View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19271_high_33 (Length: 299)
Name: NF19271_high_33
Description: NF19271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19271_high_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 10 - 152
Target Start/End: Complemental strand, 48960855 - 48960713
Alignment:
| Q |
10 |
agatgaagaagaattaggaaacaagcccctatgaggtggagatgaaaatgtttgttctgttttcttttcttgaggttgagtctgattatgaggtgatggg |
109 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48960855 |
agatgaagaagaattgggaaacaagcccctatgaggtggagatgaaagtgtttgttctgttttcttttcttgaggttgagtttgattatgaggtgatggg |
48960756 |
T |
 |
| Q |
110 |
ggtgctgaagcagtcctaaatgtgggtagagacatagtagggc |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48960755 |
ggtgctgaagcagtcctaaatgtgggtagagacatagtagggc |
48960713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 284
Target Start/End: Complemental strand, 48960629 - 48960569
Alignment:
| Q |
224 |
cgaatggaggttaagcggaaccatggacgaaccgggggtgggttagccatggtgtttcttt |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48960629 |
cgaatggaggttaagcggaaccatggacgaaccgggggtgggttagccatggcgtttcttt |
48960569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University