View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19271_high_56 (Length: 235)
Name: NF19271_high_56
Description: NF19271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19271_high_56 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 13 - 218
Target Start/End: Original strand, 22272753 - 22272958
Alignment:
| Q |
13 |
gagaagaaagctgcaaatgtctagcaagtgttgatattaactatttgactaaattcagatggtcaaatgtttgttggtaggattttgctacatgaagtat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||| | ||| |
|
|
| T |
22272753 |
gagaagaaagctgcaaatgtctagcaagtgttgatattaactatttgactgaattcagattgtcaaatgtttgttgctaggattttgctacatgtaatat |
22272852 |
T |
 |
| Q |
113 |
attgctagtagatattgattagggaatgatatgctttgaatccatgagtagatataatggcattgcaccaactataacgaattttgtccatagacatgat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22272853 |
attgctagtagatattgattagggaatgatatgctttgaatacataagtagatataatggcattgcaccaactataacgaattttgtccatagacatgat |
22272952 |
T |
 |
| Q |
213 |
aagtat |
218 |
Q |
| |
|
|||||| |
|
|
| T |
22272953 |
aagtat |
22272958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University