View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19271_high_61 (Length: 208)
Name: NF19271_high_61
Description: NF19271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19271_high_61 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 29261681 - 29261887
Alignment:
| Q |
1 |
tagaagcgattggtacacccttgcttttgcttttgcttttgtaatgcttctcctctgaaaccattttaatagattgagtatgcattatttatatttcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29261681 |
tagaagcgattggtacacccttgcttttgcttttgcttttgtaatgcttctcctctgaaaccattttaatagattgagtatgcattatttatatttcttt |
29261780 |
T |
|
| Q |
101 |
ccatgaatgaataactaaatctcaaggcattgcttgtgcaattgcgttggaatgcaatcaagaacaaacatgaaagtgactattattgaagttaggaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29261781 |
ccatgaatgaataactaaatctcaaggcattgcttgtgcaattgcgttggaatgcaatcaagaacaaacatgaaagtgactattattgaagttaggaatt |
29261880 |
T |
|
| Q |
201 |
attcctc |
207 |
Q |
| |
|
||||||| |
|
|
| T |
29261881 |
attcctc |
29261887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University