View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19271_high_62 (Length: 205)
Name: NF19271_high_62
Description: NF19271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19271_high_62 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 7e-88; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 22 - 189
Target Start/End: Original strand, 35036360 - 35036527
Alignment:
| Q |
22 |
ttagggactttttcgatctcagcggttcatttgttatatctgacatgttgcggtttttgagatggttggatttggatggaaaacagaagcagatgaagaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35036360 |
ttagggactttttcgatctcagcggttcatttgttatatctgacatgttgcggttttttagatggttggatttggatggaaaacagaagcagatgaagaa |
35036459 |
T |
 |
| Q |
122 |
aacggctaaagagttagatgattttgttcaagtttggctcgatcaacacaaacgcaacaagaaacctg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35036460 |
aacggctaaagagttagatgattttgttcaagtttggctcgatcaacacaaacgcaacaagaaacctg |
35036527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 20 - 174
Target Start/End: Original strand, 35020159 - 35020313
Alignment:
| Q |
20 |
gattagggactttttcgatctcagcggttcatttgttatatctgacatgttgcggtttttgagatggttggatttggatggaaaacagaagcagatgaag |
119 |
Q |
| |
|
|||||| || ||||| |||| || |||||||||||| | ||||||||||| | || |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35020159 |
gattagagatttttttaatcttagtggttcatttgttgtttctgacatgttaccgtatttgagatggttggatttggatggaaaacagaagcaaatgaag |
35020258 |
T |
 |
| Q |
120 |
aaaacggctaaagagttagatgattttgttcaagtttggctcgatcaacacaaac |
174 |
Q |
| |
|
||||| || |||||||||||||| |||||| |||||||| ||||| ||||||| |
|
|
| T |
35020259 |
aaaacagcaaaagagttagatgactttgtttgtgtttggcttgatcagcacaaac |
35020313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 45 - 175
Target Start/End: Original strand, 35044514 - 35044644
Alignment:
| Q |
45 |
ggttcatttgttatatctgacatgttgcggtttttgagatggttggatttggatggaaaacagaagcagatgaagaaaacggctaaagagttagatgatt |
144 |
Q |
| |
|
||||| |||||||||||||| ||||| |||||| |||||||||||||||||||||||| ||||| | ||||||||||| ||||||||||| ||||| | |
|
|
| T |
35044514 |
ggttcctttgttatatctgattcgttgccgtttttaagatggttggatttggatggaaaagagaaggaaatgaagaaaactgctaaagagttggatgagt |
35044613 |
T |
 |
| Q |
145 |
ttgttcaagtttggctcgatcaacacaaacg |
175 |
Q |
| |
|
||||||||| |||| | |||||||||||||| |
|
|
| T |
35044614 |
ttgttcaaggttggattgatcaacacaaacg |
35044644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University