View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19271_low_27 (Length: 310)
Name: NF19271_low_27
Description: NF19271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19271_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 11 - 295
Target Start/End: Original strand, 38580698 - 38580982
Alignment:
| Q |
11 |
aagaaagctacagagtttgtggtaggatacaaaatattaatagcctttaccactcatacggtaaccagcctttttggacttgctatttggttcacagtga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38580698 |
aagaaagctacagagtttgtggtaggatacaaaatattaatagcctttaccactcatacggtaaccagcttttttggacttgctatttggttcacagtga |
38580797 |
T |
 |
| Q |
111 |
tcaacatcctgtaaaattttaaaaggtgcaatacgtaaacaaactcaatgataaatggtaatatgtaattataaaccccaaatgatccgcggttattagt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38580798 |
tcaacatcctgtaaaattttaaaaggtgcaatacgtaaacaaactcaatgataaatggtaatatgtaattataaaccccaaatgatccgcagttattagt |
38580897 |
T |
 |
| Q |
211 |
tattaccatagcttcagcagcacctagagcttgttggacctcaacgtatttacgctcagtcaactcagaatggatcacacgtttt |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38580898 |
tattaccatagcttcagcagcacctagagcttgttggacctcaacatatttacgctcagtcaactcagaatggatcacacgtttt |
38580982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University