View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19271_low_38 (Length: 286)
Name: NF19271_low_38
Description: NF19271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19271_low_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 17 - 278
Target Start/End: Original strand, 20047512 - 20047774
Alignment:
| Q |
17 |
agtattggcatgtatggtgagaacacttggttaatgtgatgaaaaaacaatgaagtgaatctaagcaatactggaacaaatgcaaaactcttatgtttat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||| |
|
|
| T |
20047512 |
agtattggcatgtatggtgagaacacttggttaatgtgatgaaaaaacaatgaagtgaatctaagcaatactggaactaatgcaaaactttcatgtttat |
20047611 |
T |
 |
| Q |
117 |
aattctttccaaactgcatcatgattgattaatggagcttttatttctcttaaaactgcatca-aacggatctaaattctctgctgtcaatttctttctg |
215 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
20047612 |
aattatttccaaactgcatcatgagtgattaatggagcttttatttctcttaaaactgcatcataacggatctaaattctctgctgtcaatttctttctg |
20047711 |
T |
 |
| Q |
216 |
ctatcctacaaactccatatccctctcttcatcatctcaaatttttcttatacaatctgtgct |
278 |
Q |
| |
|
|| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20047712 |
ctctcctacaaactccaaatccctctcttcatcatctcaaatttttcttatacaatctgtgct |
20047774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University