View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19271_low_48 (Length: 250)
Name: NF19271_low_48
Description: NF19271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19271_low_48 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 3161733 - 3161485
Alignment:
| Q |
1 |
atatagaaggagaagaaaaatccatgccaattgatgtttgtgagnnnnnnngaaagagttgatgtttgtgagttgtcaccctcttcttatccaatgttac |
100 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3161733 |
atatagaaggagaagaaaaaaccatgctaattgatgtttgtgagtttttt-gaaagagttgatgtttgtgagttgtcaccctcttcttatccgatgttac |
3161635 |
T |
 |
| Q |
101 |
caaaacaaattgaaataatgacggaaactagagacggaaaaaataaaatttagcgtcaagtttgatctggcgtctctaatgcttggcgatggaattagag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3161634 |
caaaacaaattgaaataatgacggaaactagagacggaaaaaataaaatttagcgtcaagtttggtctggcgtctctaatgcttggcgatgggattagag |
3161535 |
T |
 |
| Q |
201 |
gctgatgttgcattttctttgtctctaaacttatgtcgctatttcaagtt |
250 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
3161534 |
gctgatgttgcattttcttcgtctctaaatttatgtcgctatttcaagtt |
3161485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University