View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19271_low_51 (Length: 247)
Name: NF19271_low_51
Description: NF19271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19271_low_51 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 81 - 247
Target Start/End: Original strand, 28676689 - 28676854
Alignment:
| Q |
81 |
cattgaaaatttcgtttttatctggcta-aggtttagactgtttcctcgggcttttgctttgttacattttctgagcacacaaatgctgttacggctctg |
179 |
Q |
| |
|
||||||||||||| |||||||||| ||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28676689 |
cattgaaaatttcatttttatctg-ctataggtttggactgtttcctcgggcttttgctttgttacattttctgagcacacaaatgctgttacggctctg |
28676787 |
T |
 |
| Q |
180 |
cattttatggcaagtaacaattgccttctcagtgcatctcttgatgggactattccgtgtgtgggatt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
28676788 |
cattttatggcaagtaacaattgccttctcagtgcatctcttgatgggactatt-cgtgcgtgggatt |
28676854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 73
Target Start/End: Original strand, 28676591 - 28676648
Alignment:
| Q |
16 |
agtataaggatacacgtttagctagggtttttcagattgcaactttgataatcagtgt |
73 |
Q |
| |
|
|||||||| ||||||||||| |||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
28676591 |
agtataagtttacacgtttaggtagggtgtttcacattgcaactttgataatctgtgt |
28676648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University