View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19271_low_55 (Length: 237)

Name: NF19271_low_55
Description: NF19271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19271_low_55
NF19271_low_55
[»] chr7 (1 HSPs)
chr7 (1-144)||(28677153-28677296)


Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 28677153 - 28677296
Alignment:
1 gtgagttagcttgtcttccattgttatcatctacataagttgatgtcttgttatcctctataatgtgtttagttgattttatttttatgttgttacagtt 100  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
28677153 gtgagttagcttttcttccattgttatcatctacataagttgatgtcttgttatcctgtataatgtgtttagttgattttatttttatgttgttacagtt 28677252  T
101 tctacttgttagaaatacaatgtctctatgaagccatggtttaa 144  Q
    ||||| |||||||||||||||||||||||||||||||| |||||    
28677253 tctacatgttagaaatacaatgtctctatgaagccatgatttaa 28677296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University