View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19271_low_56 (Length: 235)

Name: NF19271_low_56
Description: NF19271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19271_low_56
NF19271_low_56
[»] chr7 (1 HSPs)
chr7 (13-218)||(22272753-22272958)


Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 13 - 218
Target Start/End: Original strand, 22272753 - 22272958
Alignment:
13 gagaagaaagctgcaaatgtctagcaagtgttgatattaactatttgactaaattcagatggtcaaatgtttgttggtaggattttgctacatgaagtat 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||| | |||    
22272753 gagaagaaagctgcaaatgtctagcaagtgttgatattaactatttgactgaattcagattgtcaaatgtttgttgctaggattttgctacatgtaatat 22272852  T
113 attgctagtagatattgattagggaatgatatgctttgaatccatgagtagatataatggcattgcaccaactataacgaattttgtccatagacatgat 212  Q
    ||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22272853 attgctagtagatattgattagggaatgatatgctttgaatacataagtagatataatggcattgcaccaactataacgaattttgtccatagacatgat 22272952  T
213 aagtat 218  Q
    ||||||    
22272953 aagtat 22272958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University