View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19273_high_11 (Length: 261)
Name: NF19273_high_11
Description: NF19273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19273_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 3 - 99
Target Start/End: Original strand, 29671081 - 29671177
Alignment:
| Q |
3 |
gaagagggtatgttggtaatttttgtagtgatgaaggtgttggttttaatatagttttcaagtatgtaggacttaggttttgatcccttgaaattag |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29671081 |
gaagagggtatgttggtaatttttgtagtgatgaaggtgttggttttgatatagttttcaagtatgtaggacttaggttttgatcccttgaaattag |
29671177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 165 - 245
Target Start/End: Original strand, 29671243 - 29671323
Alignment:
| Q |
165 |
atggcattttcagttcttcctggaatcttctttgctatctcagcccaacggtttccaattttggcatgtgtagctactaat |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29671243 |
atggcattttcagttcttcctggaatcttctttgctatctcagcccaacggtttccaattttggcatgtgtagctactaat |
29671323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 168 - 223
Target Start/End: Original strand, 25379293 - 25379348
Alignment:
| Q |
168 |
gcattttcagttcttcctggaatcttctttgctatctcagcccaacggtttccaat |
223 |
Q |
| |
|
||||| ||||||||||| ||||| ||||||||||||| |||||||| |||||||| |
|
|
| T |
25379293 |
gcattctcagttcttccaggaattctctttgctatctctgcccaacgatttccaat |
25379348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University