View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19273_low_12 (Length: 261)

Name: NF19273_low_12
Description: NF19273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19273_low_12
NF19273_low_12
[»] chr5 (2 HSPs)
chr5 (3-99)||(29671081-29671177)
chr5 (165-245)||(29671243-29671323)
[»] chr3 (1 HSPs)
chr3 (168-223)||(25379293-25379348)


Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 3 - 99
Target Start/End: Original strand, 29671081 - 29671177
Alignment:
Q  3 gaagagggtatgttggtaatttttgtagtgatgaaggtgttggttttaatatagttttcaagtatgtaggacttaggttttgatcccttgaaattag 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  29671081 gaagagggtatgttggtaatttttgtagtgatgaaggtgttggttttgatatagttttcaagtatgtaggacttaggttttgatcccttgaaattag 29671177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 165 - 245
Target Start/End: Original strand, 29671243 - 29671323
Alignment:
Q  165 atggcattttcagttcttcctggaatcttctttgctatctcagcccaacggtttccaattttggcatgtgtagctactaat 245  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29671243 atggcattttcagttcttcctggaatcttctttgctatctcagcccaacggtttccaattttggcatgtgtagctactaat 29671323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 168 - 223
Target Start/End: Original strand, 25379293 - 25379348
Alignment:
Q  168 gcattttcagttcttcctggaatcttctttgctatctcagcccaacggtttccaat 223  Q
    ||||| ||||||||||| |||||  ||||||||||||| |||||||| ||||||||    
T  25379293 gcattctcagttcttccaggaattctctttgctatctctgcccaacgatttccaat 25379348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University