View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19274_high_9 (Length: 264)
Name: NF19274_high_9
Description: NF19274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19274_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 94 - 211
Target Start/End: Complemental strand, 40765530 - 40765414
Alignment:
| Q |
94 |
ttttcatctaaattagagtagtttacttttatagtttactgttactaccacgactagaggttgtaagtttattgccgcgagttttgttctgctttgtgtc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40765530 |
ttttcatctaaattagagtagtttacttttatagtttactgttactaccacgactagaggttgtaag-ttattgccgcgagttttgttctgctttgtgtc |
40765432 |
T |
|
| Q |
194 |
cgaaacaagtttcactca |
211 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
40765431 |
cgaaacaagtttcactca |
40765414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 10 - 66
Target Start/End: Complemental strand, 40765613 - 40765557
Alignment:
| Q |
10 |
agtgatatgaatttatagatttgttaattatttaaataaaatggtaagtattgtaac |
66 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40765613 |
agtgatatgaatttatagatatgttaattatttaaataaaatgataagtattgtaac |
40765557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University