View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19274_low_14 (Length: 215)

Name: NF19274_low_14
Description: NF19274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19274_low_14
NF19274_low_14
[»] chr4 (1 HSPs)
chr4 (12-197)||(32066759-32066944)


Alignment Details
Target: chr4 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 12 - 197
Target Start/End: Complemental strand, 32066944 - 32066759
Alignment:
12 aagaatatggacccacaacctgaaacaaaaatcatgaaggataaaaatctcatactaagctgaaaatctttaggagctgaaattataagctatgaaagca 111  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32066944 aagaaaatggacccacaacctgaaacaaaaatcatgaaggataaaaatctcatactaagctgaaaatctttaggagctgaaattataagctatgaaagca 32066845  T
112 gatatgaatctgaacaaaagaaaaatgttgaaacagtgagaaagtattcaccagttagagccactgttgacatttgatatggtaaa 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32066844 gatatgaatctgaacaaaagaaaaatgttgaaacagtgagaaagtattcaccagttagagccactgttgacatttgatatggtaaa 32066759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University