View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19274_low_14 (Length: 215)
Name: NF19274_low_14
Description: NF19274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19274_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 12 - 197
Target Start/End: Complemental strand, 32066944 - 32066759
Alignment:
| Q |
12 |
aagaatatggacccacaacctgaaacaaaaatcatgaaggataaaaatctcatactaagctgaaaatctttaggagctgaaattataagctatgaaagca |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32066944 |
aagaaaatggacccacaacctgaaacaaaaatcatgaaggataaaaatctcatactaagctgaaaatctttaggagctgaaattataagctatgaaagca |
32066845 |
T |
 |
| Q |
112 |
gatatgaatctgaacaaaagaaaaatgttgaaacagtgagaaagtattcaccagttagagccactgttgacatttgatatggtaaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32066844 |
gatatgaatctgaacaaaagaaaaatgttgaaacagtgagaaagtattcaccagttagagccactgttgacatttgatatggtaaa |
32066759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University