View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19275_high_3 (Length: 414)
Name: NF19275_high_3
Description: NF19275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19275_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 136 - 406
Target Start/End: Original strand, 26861944 - 26862214
Alignment:
| Q |
136 |
agtaatcaaatcaacgtgtctattggattaattcttcatatatcaatgaagggtgaaacagtgaacgtaacatggctaggtggtatttggccagtttcac |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26861944 |
agtaatcaaatcaacgtgtctattggattaattcttcctatatcaatgaagggtgaaacagtgaacgtaacatggctaggtggtatttggccagtttcac |
26862043 |
T |
 |
| Q |
236 |
gcaagagtggttcagatgaaaataatgaaattggaattatggcatttgaggttgcagggttgatgtctaaggttgttaatttatggcattctttgagtga |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26862044 |
gcaagagtggttcagatgaaaataatgaaattggaattatggcatttgaggttgcagggttgatgtctaaggttgttaatttatggcattctttgagtga |
26862143 |
T |
 |
| Q |
336 |
caatgaattaatgaacctaagagaatggatagtaagttcagttggtgtcaaaatgcttgtttctgatgatg |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26862144 |
caatgaattaatgaacctaagagaatggatagtaagttcagttggtgtcaaaatgcttgtttctgatgatg |
26862214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University