View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19277_high_12 (Length: 306)
Name: NF19277_high_12
Description: NF19277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19277_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 247 - 298
Target Start/End: Complemental strand, 27564179 - 27564128
Alignment:
| Q |
247 |
tattagtaataaaagtcatttatgttcctttctatcattcatcatattcttc |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27564179 |
tattagtaataaaagtcatttatgttcctttctatcattcatcatattcttc |
27564128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University