View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19277_high_13 (Length: 303)
Name: NF19277_high_13
Description: NF19277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19277_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 19 - 292
Target Start/End: Original strand, 41931456 - 41931725
Alignment:
| Q |
19 |
gacatacattaaaaaactcgaatgagcaatccatccacaaaatgtcgataaaacaatcgtaaaacataacctcctcttgtcatttctggactgagtgtta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41931456 |
gacatacattaaaaaactcgaatgagcaatccaaccacaaaatatcgataagacaatcgtaaaacataacttcctcttgtcatttctggactgagtgtta |
41931555 |
T |
|
| Q |
119 |
gaaacaaaacttgcaatgcaagaagtgtatctagaaggagctttttcatgacaaatttgcaacagataggaggaaaaatagtaataataacccaccactt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41931556 |
gaaacaaaacttgcaatgcaagaagtgtatccaga----gctttttcatgacaaatttgcaacagataggaggaaaaatagtaataataacccaccactt |
41931651 |
T |
|
| Q |
219 |
ctaaaaattcatcccacgaatatattttcacccccaacttctcaacttcttgcttttgttcttcagaaactttt |
292 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41931652 |
ctaaaaattcatcccatgaatatattttcacccccaacttctcaacttcttgcttttgttcttcagaaactttt |
41931725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University