View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19277_high_24 (Length: 247)
Name: NF19277_high_24
Description: NF19277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19277_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 24 - 236
Target Start/End: Complemental strand, 4030956 - 4030744
Alignment:
| Q |
24 |
gcaaagattcttgagtactcttggattttcagttcagacaaaaatccgagtttcttactgaaaaatgatgctttctgtttcatgttttatttcatcttat |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4030956 |
gcaaagattcttgagtactcttggattttcagttcagacaaaaatccgagtttcttactgaaaaatgatgctttctgtttcatgttttatttcatcttat |
4030857 |
T |
|
| Q |
124 |
tatagactatactttctttaatatgaagcaatgtgtctcaacaagcttcacaatatcttttaaattgacctggaccccactataattgtattcatactat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4030856 |
tatagactatactttctttaatatgaagcaatgtgtctcaacaagcttcacaatatcttttaaattgacctggaccccactataattgtattcatactat |
4030757 |
T |
|
| Q |
224 |
ttccctttgcttc |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4030756 |
ttccctttgcttc |
4030744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University