View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19277_low_12 (Length: 306)

Name: NF19277_low_12
Description: NF19277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19277_low_12
NF19277_low_12
[»] chr5 (1 HSPs)
chr5 (247-298)||(27564128-27564179)


Alignment Details
Target: chr5 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 247 - 298
Target Start/End: Complemental strand, 27564179 - 27564128
Alignment:
247 tattagtaataaaagtcatttatgttcctttctatcattcatcatattcttc 298  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
27564179 tattagtaataaaagtcatttatgttcctttctatcattcatcatattcttc 27564128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University