View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19277_low_23 (Length: 250)
Name: NF19277_low_23
Description: NF19277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19277_low_23 |
 |  |
|
| [»] scaffold1019 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 9 - 163
Target Start/End: Original strand, 32489853 - 32490007
Alignment:
| Q |
9 |
tattatactagaaatggctgacttccaagagattatcttattattaaaccttacacctctagtgcattggaaatatccttgagctttctcattcacataa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32489853 |
tattatactagaaatggctgacttccaagagattatcttattattgaaccttacacctttagtgcattggaaatatccttgagctttctcattcacataa |
32489952 |
T |
 |
| Q |
109 |
atagagagaaatgctgatttaagaataacatcaatccaattgtagaaagtatcat |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32489953 |
atagagagaaatgctgatttaagaataacatcaatccaattgtagagagtatcat |
32490007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 192 - 250
Target Start/End: Original strand, 32490008 - 32490066
Alignment:
| Q |
192 |
aaaaatggtcactctagtgtgtcaaagactttgttgtgcaagagattaacagcttcaga |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32490008 |
aaaaatggtcactctagtgtgtcaaagactttgttgtgcaagagattaacagcttcaga |
32490066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1019 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold1019
Description:
Target: scaffold1019; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 173
Target Start/End: Original strand, 702 - 767
Alignment:
| Q |
108 |
aatagagagaaatgctgatttaagaataacatcaatccaattgtagaaagtatcattcaaaccaaa |
173 |
Q |
| |
|
|||||||||||| ||||| || ||||| |||||||||||||| ||||| |||||| |||||||| |
|
|
| T |
702 |
aatagagagaaaggctgactttagaatcacatcaatccaattacagaaaacatcattgaaaccaaa |
767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University