View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19277_low_30 (Length: 216)
Name: NF19277_low_30
Description: NF19277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19277_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 5 - 198
Target Start/End: Original strand, 30198731 - 30198924
Alignment:
| Q |
5 |
aggagcagcacagatgacattagcaggaagaccaattccaaaaccaacaagagtgataccaacattgaatccaacaccgcaaccagctccaacataacca |
104 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30198731 |
aggagctgcaaagatgacattagcaggaagaccaattccaaaaccaacaagagtgataccaacattgaatccaacaccgcaaccagctccaacataacca |
30198830 |
T |
 |
| Q |
105 |
acaacttcaggaccaaatccaggaccccatccaacaccacaaccaacgccgaaacccattccataaaatgctccataagttggatgaacggggt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30198831 |
acaacttcaggaccaaatccaggaccccatccaacaccacaaccaacgccgaaacccattccataaaatgctccataagttggatgaacagggt |
30198924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University