View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19278_low_10 (Length: 260)
Name: NF19278_low_10
Description: NF19278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19278_low_10 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 16 - 260
Target Start/End: Original strand, 21599767 - 21600011
Alignment:
| Q |
16 |
atgaattattttattgcttcggtatgtttacannnnnnngtctaatagattgaaaaatttgatatatacacacacattccagctcttattttaatctttt |
115 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21599767 |
atgaattattttattacttcggtatgtttacatttttttgtctaatagattgaaaaatttgatatacacacacacattccagctcttattttaatctttt |
21599866 |
T |
 |
| Q |
116 |
attgtgtagcgttactaagatgttttttggttgtttatgcgaggtaaaatcccgagggatgaattacttcatgatcttgagatcaaaaggacagtaagag |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21599867 |
attgtgtagcgttactaagatgtcttttggttgtttatgcgaggtaaaatcccgagggatgaattacttcatgatcttgagatcaaaaggacagtaagag |
21599966 |
T |
 |
| Q |
216 |
ctaaccagaaggcaatttgtttggctcagttagaagaagatacac |
260 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
21599967 |
ctaactagaaggcaatttgtttggctcaattagaagaagatacac |
21600011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University