View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19278_low_8 (Length: 276)
Name: NF19278_low_8
Description: NF19278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19278_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 70 - 204
Target Start/End: Complemental strand, 42240103 - 42239971
Alignment:
| Q |
70 |
caaaatgcaatatatatggtccaacattaagatatcnnnnnnnnnngatagaatcaaaactaagatatttcatatgaatatgaaaggaacaaaaatatct |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42240103 |
caaaatgcaatatatatggtccaacattaagatatctttttttt--gatagaatcaaaactaagatatttcatatgaatatgaaaggaacaaaaatatct |
42240006 |
T |
 |
| Q |
170 |
ctctcaacttcatgtcttcatctgattgttgaagt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42240005 |
ctctcaacttcatgtcttcatctgattgttgaagt |
42239971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 42240155 - 42240119
Alignment:
| Q |
19 |
tctttgacgtcacaaaactatgagctgacgcatgccc |
55 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42240155 |
tctttgacgtcacaaaactatgaactgacgcatgccc |
42240119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University