View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19278_low_9 (Length: 269)
Name: NF19278_low_9
Description: NF19278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19278_low_9 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 52 - 269
Target Start/End: Complemental strand, 362318 - 362101
Alignment:
| Q |
52 |
aaacacttgaaaaaggtgacatgtttattgtattggagtttgatgaagtcacaatccctattatgcctcaactaaatttgattacatacacatggccata |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |||||||||||||||| |
|
|
| T |
362318 |
aaacacttgaaaaaggtgacatgtttattgtattggagtttgatgaagtcacaatccctattatgactcaaccaaatttgatttcatacacatggccata |
362219 |
T |
|
| Q |
152 |
atccattttacttattcactattatttctctctttaagtgactaattcaacactcacaacctaccattgctatatatacatatgtatatccatagagaac |
251 |
Q |
| |
|
|||||||| | |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
362218 |
atccatttaatttattcactattatttctctttttaagtgactaattcaacactcacaacctaccattgctatatatacatatgtatatccatagagaac |
362119 |
T |
|
| Q |
252 |
tatcacttccaaatctct |
269 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
362118 |
tatcacttccaaatctct |
362101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 15 - 53
Target Start/End: Complemental strand, 362343 - 362305
Alignment:
| Q |
15 |
aatactattattcatgaccgatctcaaacacttgaaaaa |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
362343 |
aatactattattcatgaccgatctcaaacacttgaaaaa |
362305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University