View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19279_low_6 (Length: 248)
Name: NF19279_low_6
Description: NF19279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19279_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 5 - 216
Target Start/End: Original strand, 45754233 - 45754444
Alignment:
| Q |
5 |
tcgaagaatattaactaaatgttatatgnnnnnnncaatttgaaatcaattaatctcttatttaaatcttatttgcagtatattctcacaaatataggct |
104 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45754233 |
tcgaataatattaactaaatgttatatgtttttttcaatttgaaatcaattaatctcttatttaaatcttatttgcagtatattctcacaaatataggct |
45754332 |
T |
 |
| Q |
105 |
aaataattttttctggcagaaaatatagtctagatataacatcctctaaaattataaagtggaactcactaaacctacactttaagaacataacatcctc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45754333 |
aaataattttttctggcagaaaatatagtctagatataacatcctcgaaaattataaagtcgaactcactaaacctacactttaagaacataacatcctt |
45754432 |
T |
 |
| Q |
205 |
gtaatagaataa |
216 |
Q |
| |
|
|||||||||||| |
|
|
| T |
45754433 |
gtaatagaataa |
45754444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University