View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1927_high_14 (Length: 234)
Name: NF1927_high_14
Description: NF1927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1927_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 15 - 136
Target Start/End: Complemental strand, 21092073 - 21091952
Alignment:
| Q |
15 |
tgatatatataatagctgttgcaataatatggatagctgctagttttgtagtgcaatctgttgtagatgctggtgtgtcgccatttcttgttacttacat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21092073 |
tgatatatataatagctgttgcaataatatggatagctgctagttttgtagtgcaatctgttgtagatgctggtgtgtcgccatttcttgttacttacat |
21091974 |
T |
|
| Q |
115 |
atgcaattcattgtctgtggtg |
136 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
21091973 |
atgcaattcattgtttgtggtg |
21091952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University