View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1927_low_10 (Length: 327)
Name: NF1927_low_10
Description: NF1927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1927_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 30 - 315
Target Start/End: Complemental strand, 43920391 - 43920106
Alignment:
| Q |
30 |
gtattaccgcggtgccgcagcagcaattgttgtttatgacatctctagcattgtaagtattcattttgttatatttgaaaacgatcgacaatgttgttta |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43920391 |
gtattaccgcggtgccgcagcagcaattgttgtttatgacatctctagcattgtaagtattcattttgttatatttgaaaacgatcaacaatgttgttta |
43920292 |
T |
 |
| Q |
130 |
tgatccaaatttctatttcaggacacatttgttcgagcgaaaaaatgggttcaagaattgcaaagacatggtaatacctcaaacacaggaaatttaaaac |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43920291 |
tgatccaaatttctatttcaggacacatttgttcgagcgaaaaaatgggttcaggaattgcaaagacatggtaatacctcaaacacaggaaatttaaaac |
43920192 |
T |
 |
| Q |
230 |
tgtgatagcaattcatgtgcattagtaacatgttttgtttcgatcttttatcagtatttttgtaaagcttatatatatttgagtat |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43920191 |
tgtgatagcaattcatgtgcattagtaacatgttttgtttcgatcttttatcagtatttttgtaaagcttatatctatttgagtat |
43920106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University