View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1927_low_12 (Length: 313)

Name: NF1927_low_12
Description: NF1927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1927_low_12
NF1927_low_12
[»] chr1 (1 HSPs)
chr1 (106-199)||(8052584-8052677)


Alignment Details
Target: chr1 (Bit Score: 94; Significance: 7e-46; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 106 - 199
Target Start/End: Original strand, 8052584 - 8052677
Alignment:
106 gtatgattaatcatagaacgctgatttgtgtaggatgtttaatacttttccactcataatgtactctcagccataaaatatggttgaaagaaga 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8052584 gtatgattaatcatagaacgctgatttgtgtaggatgtttaatacttttccactcataatgtactctcagccataaaatatggttgaaagaaga 8052677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University