View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1927_low_19 (Length: 283)
Name: NF1927_low_19
Description: NF1927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1927_low_19 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 29 - 283
Target Start/End: Complemental strand, 12847186 - 12846932
Alignment:
| Q |
29 |
actccaagcaatatatgagtactaaatgaattatttaaaccaaacactttctcaaagtccatctagtacaattactttgtgttggagaaagtaataatca |
128 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12847186 |
actccaagcaatacatgagtactaaatgaattatttaaaccaaacactttctcaaagtccatctagtacaattactttgtgttggagaaagtaataatca |
12847087 |
T |
|
| Q |
129 |
aaagaagtataacaccagagcaacaaacgtcaagtatatattgtctccttattacaatgactcgggtactacaatacaatgactgttgttatcactatct |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12847086 |
aaagaagtataacaccagagcaacaaacgtcaagtatatattgtctccttattacaatgactcgggtactacaatacaatgactgttgttatcactatct |
12846987 |
T |
|
| Q |
229 |
attgatggaagtgaaacacctaattagtattgatatgaatagcttttctttttgt |
283 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12846986 |
attgatggaagtgaaacacctaaatagtattgatatgaatagcttttctttttgt |
12846932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University