View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1927_low_20 (Length: 280)
Name: NF1927_low_20
Description: NF1927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1927_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 3 - 251
Target Start/End: Complemental strand, 42551432 - 42551179
Alignment:
| Q |
3 |
catctccaacaatatataaatgttgcttatatctaaacttctgcaccatacaa-cttttctccatagttcatcaattttcttatgagtgtattctcttga |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42551432 |
catctccaacaatatataaatgttgcttatatctaaacttctgcaccatacactcttttctccatagttcatcaattttcttatgagtgtattctcttga |
42551333 |
T |
 |
| Q |
102 |
aatattcatatagcaaagctacttt----gttctatacatggcttcaaatatttgcaaaccttcacgtcgtgataattctctaataataaaaccaaccaa |
197 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42551332 |
aatattcatatagcaaatctactttaattgttctatacatggcttcaaatatttgcaaaccttcacgtcgtgataattctctaataataaaaccaaccaa |
42551233 |
T |
 |
| Q |
198 |
atatacctcaaagcctacccttttgctcaaagactacctccgagatgacctaag |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42551232 |
atatacctcaaagcctacccttttgctcaaagactacctccgagatgacctaag |
42551179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University