View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19281_high_12 (Length: 350)
Name: NF19281_high_12
Description: NF19281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19281_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 16 - 332
Target Start/End: Original strand, 9412219 - 9412535
Alignment:
| Q |
16 |
acagagcaaaaacctgtatacagtagcagaagtttctgtcagtttcatttcaattattagtagcataacatagcaacaacatttaaaagaggcatagcag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9412219 |
acagagcaaaaacctgtatacagtagcagaagtttctgtcagtttcatttcaattattagtagcataacatagcaacaacatttaaaagaggcatagcag |
9412318 |
T |
|
| Q |
116 |
caaggtttcaaaaacaagttcgagaccgcaatcttgctgcagcatcattgcttttttatattttcacaacaacaattgaagttgcatcagtcacatttac |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9412319 |
caaggtttcaaaaacaagttcgacaccgcaatcttgctgcagcatcattgcttttttatattttcacaacaacaattgaagttgcatcagtcacatttac |
9412418 |
T |
|
| Q |
216 |
tatgattctctgcaatatcaatgattgcaatagtatccacagccacaattcaaaaccatgtatattagtagtttatagtgtaagaaactactcatgaaca |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9412419 |
tatgattctctgcaatatcaatgattgcaatagtatccacagccacaattcaaaaccttggatattagtagtttatagtttaagaaactactcatgaaca |
9412518 |
T |
|
| Q |
316 |
acagttgaagttgcgtc |
332 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
9412519 |
acagttgaagttgcgtc |
9412535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University