View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19281_high_18 (Length: 254)
Name: NF19281_high_18
Description: NF19281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19281_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 32373946 - 32373708
Alignment:
| Q |
1 |
cagacaggaatgtcattaaaaatgctgttttgcaacgagtctgcatggtgaatcccctgttgcagccagttgccttttcacggtttgagtctgctacacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32373946 |
cagacaggaatgtcattaaaaatgctgttttgcaacgagtctgcatggtgaatcccctgttgcagccagttgccttttcacggtttgagtctgctacacc |
32373847 |
T |
 |
| Q |
101 |
tgttcgtattgaggagcatggtttcgagagcaccacaatttcagacatcttgcaaggaaaaggtaaaggcgctgatggttcccggctttggtgcaccaca |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32373846 |
tgctcgtattgaggagcatggtttcgagagcaccacaatttcagacatcttgcaaggaaaaggtaaaggcgctgatggttcccggctttggtgcaccaca |
32373747 |
T |
 |
| Q |
201 |
gatgacactgtttatgatgctgtcaaatcggtaatgcat |
239 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32373746 |
gatgacactgtttatgatgctgtgaaatcggtaatgcat |
32373708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 7 - 239
Target Start/End: Complemental strand, 32409976 - 32409744
Alignment:
| Q |
7 |
ggaatgtcattaaaaatgctgttttgcaacgagtctgcatggtgaatcccctgttgcagccagttgccttttcacggtttgagtctgctacacctgttcg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
32409976 |
ggaatgtcattaaaaatgctgttttgcaacgagtccgcatggtgaatcccctgttgcagccagttgccttttcacggtttgagtctgccacacctgctcg |
32409877 |
T |
 |
| Q |
107 |
tattgaggagcatggtttcgagagcaccacaatttcagacatcttgcaaggaaaaggtaaaggcgctgatggttcccggctttggtgcaccacagatgac |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32409876 |
tattgaggagcatggtttcgagagcaccacaatttcagacatcttgaaaggaaaaggtaaaggtgctgatggttcctggctttggtgcaccacagatgac |
32409777 |
T |
 |
| Q |
207 |
actgtttatgatgctgtcaaatcggtaatgcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32409776 |
actgtttatgatgctgtcaaatcggtaatgcat |
32409744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 12 - 239
Target Start/End: Original strand, 13179314 - 13179541
Alignment:
| Q |
12 |
gtcattaaaaatgctgttttgcaacgagtctgcatggtgaatcccctgttgcagccagttgccttttcacggtttgagtctgctacacctgttcgtattg |
111 |
Q |
| |
|
|||||| |||||| | |||||||||||||| ||| ||||||||| ||||||||||||||| ||||||||| |||||||| ||||||||||| | |||||| |
|
|
| T |
13179314 |
gtcattcaaaatgtttttttgcaacgagtccgcacggtgaatcctctgttgcagccagtttccttttcacagtttgagtatgctacacctgcttgtattg |
13179413 |
T |
 |
| Q |
112 |
aggagcatggtttcgagagcaccacaatttcagacatcttgcaaggaaaaggtaaaggcgctgatggttcccggctttggtgcaccacagatgacactgt |
211 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13179414 |
aggagcatggttttgagagcaccacaatttcagacatcttgcaaggaaaaggtaaaggtgctaatggttccttgctttggtgcaccacagatgacactgt |
13179513 |
T |
 |
| Q |
212 |
ttatgatgctgtcaaatcggtaatgcat |
239 |
Q |
| |
|
||||| |||||||||||||||||||||| |
|
|
| T |
13179514 |
ttatgttgctgtcaaatcggtaatgcat |
13179541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University