View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19281_high_22 (Length: 227)
Name: NF19281_high_22
Description: NF19281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19281_high_22 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 19256435 - 19256665
Alignment:
| Q |
1 |
attttatcttttatacctcatatagctt----gttattcaacaaaatgatcaaaccaaggtacttcctaatgatgcataatgtaacacaaatttacattt |
96 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19256435 |
attttatcttttatacctcatatagcttgcttgttattcaacaaaatgatcaaaccaaggtacttcctaatgatgcataatgtaacacaaatttacattt |
19256534 |
T |
 |
| Q |
97 |
ttaagaaaattaatattattattaaagtatacaaaaaattgtacctgtcaagttcagttcccatgctaattgccatacccttcaaatcacccaagatatc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19256535 |
ttaagaaaattaatattattattaaagtatacaaaaaattgtacctgtcaagttcagttcccatactaattgccatacccttcaaatcacccaagatatc |
19256634 |
T |
 |
| Q |
197 |
actgagctctgagagtccatcatcttgttta |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
19256635 |
actgagctctgagagtccatcatcttgttta |
19256665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University