View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19281_low_1 (Length: 669)
Name: NF19281_low_1
Description: NF19281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19281_low_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 1e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 1e-67
Query Start/End: Original strand, 464 - 662
Target Start/End: Original strand, 5360888 - 5361086
Alignment:
| Q |
464 |
catttaaaatgaataaatggaaaatttaatgtttaaactccacccctacatatatagtataatgttcatattaattgagttatgctcacgaaaattgtaa |
563 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |||||| ||||||| ||||||||| | || | |||||||||| |
|
|
| T |
5360888 |
catttaaagtgaataaatggaaaatttaattattaaactccacccctacatatataatataatattcatatcaattgagttgtacttataaaaattgtaa |
5360987 |
T |
 |
| Q |
564 |
ttggacatttctagaatttatttatatggcaaaaatcatataagaaaagttttttaaaaggcaatactattgtataaggaaaaacatattcttggacat |
662 |
Q |
| |
|
|| |||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |||||| |||||||| |
|
|
| T |
5360988 |
tttgacatttctagaatttgtttatatggcaaaaatcatataaaaaaagttttttaaaaggcaatactattgtataagaaaaatcatattattggacat |
5361086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University