View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19281_low_17 (Length: 274)
Name: NF19281_low_17
Description: NF19281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19281_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 9 - 257
Target Start/End: Complemental strand, 56357837 - 56357589
Alignment:
| Q |
9 |
agcacagaccaattggattcaacacttctggagaaatgtgggtcacagctgattctgattctcgttcctttacaaagtgtcttgtctctttcaaccctga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56357837 |
agcacagaccaattggattcaacacttctggagaaatgtgggtcacagctgattctgattctcgttcctttacaaagtgtcttgtctctttcaaccctga |
56357738 |
T |
 |
| Q |
109 |
aacaggtgtctttagaaacattgagattggaggagctgcttcaaacattcaagccactcctcaggttttgagctatttttccattaagaaaatggttaat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56357737 |
aacaggtgtctttagaaacattgagattggaggagctgcttcaaacattcaagccactcctcaggttttgagctatttttccattaagaaaatggttaat |
56357638 |
T |
 |
| Q |
209 |
attcgtcacagcaaacttcaacttcagacattaaggtctgccaagaacc |
257 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
56357637 |
attcgtcacagcaaacttcagcttcagacattaaggtctgccaagaacc |
56357589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University