View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19281_low_20 (Length: 243)
Name: NF19281_low_20
Description: NF19281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19281_low_20 |
 | |
|
| [»] scaffold0205 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0205 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: scaffold0205
Description:
Target: scaffold0205; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 19032 - 19270
Alignment:
| Q |
1 |
tactcatatacaatcaacatgaagcgatcttttgtagaagaacctaatagcatgaccacattgttatgtctagctttgaggatggtttgaacttctgact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19032 |
tactcatatacaatcaacatgaagcgatcttttgtagaagaacctaatagcatgaccacattgttatgtctagctttgaggatggtttgaacttctgact |
19131 |
T |
|
| Q |
101 |
tcattttttccttaactttattgttcgttatttcatgctgcttaactactattttaagatctccttctagcttgcctttgaaagtggagaatgcatttcc |
200 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
19132 |
tcattttttccttaacttgaatgttcgttatttcatgctgcttaactactattttaagatctccttccagcttgcctttgaaagcggagaatggatttcc |
19231 |
T |
|
| Q |
201 |
actttcagagagacagttcttcaatgaaaatccatctgt |
239 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19232 |
actttcagagatacagttcttcaatgaaaatccatctgt |
19270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University