View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19281_low_21 (Length: 238)
Name: NF19281_low_21
Description: NF19281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19281_low_21 |
 |  |
|
| [»] scaffold0205 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0205 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: scaffold0205
Description:
Target: scaffold0205; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 18786 - 18562
Alignment:
| Q |
1 |
tacacatgacttcaaaccaatggtacataaccttgacaactat---gttgaatatacattttcaatatgaatatatacatttt-tcattttatggaacta |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18786 |
tacacatgacttcaaaccaatggtacataaccttgacaataattgtgttgaatatacattttcaatatgaatatatacattttctcattttatggaacta |
18687 |
T |
 |
| Q |
97 |
actcttattgtaaatgataaaaatgtttttagcttggagattttgacattggnnnnnnnctcgaaccaaagaagtcctgcaataataaaatcatagggaa |
196 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18686 |
actcttattgtaaatgataaacatgtttttagcttggagattttgaccttggaaaaaaactcgaaccaaagaagtcctgcaataataaaatcatagggaa |
18587 |
T |
 |
| Q |
197 |
ttctgaatacattgcacccgagtat |
221 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
18586 |
ttctgaatacattgcacccgagtat |
18562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University