View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19281_low_24 (Length: 218)
Name: NF19281_low_24
Description: NF19281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19281_low_24 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 74 - 218
Target Start/End: Original strand, 15148200 - 15148345
Alignment:
| Q |
74 |
tgattattataatttgcagtcttagacaattactttgttgaaagatagagatgttcctagaaatataagactagacaaaggtcttgaaacatgagaatag |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15148200 |
tgattattataatttgcagtcttagacaattactttgttgaaagataaagatgttcctagaaatataagactagacaaaggtcttgaaacatgagaatag |
15148299 |
T |
 |
| Q |
174 |
ctt-aaggcttttgggatgtaatgaataatatggtgcaatcggtct |
218 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15148300 |
cttaaaggcttttgggatgtaatgaataatatggtgcaatcggtct |
15148345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University