View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19283_high_10 (Length: 227)
Name: NF19283_high_10
Description: NF19283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19283_high_10 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 38 - 227
Target Start/End: Original strand, 7467752 - 7467941
Alignment:
| Q |
38 |
acatcatttccataactaatagaggataaaagattcattgtggtatatgattttataattcaccacaatttattcttgtaggtactatcagttcttggat |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7467752 |
acatcatttccataactaatagaggataaaagattcattgtggtatatgattttataattcaccacaatttattcttgtaggtactatcagttcttggat |
7467851 |
T |
 |
| Q |
138 |
tgtttgtttgcactgagatgagcacttgttgatatgattatatttattaatacatcttgttttaaatactctttttgcatattttactca |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7467852 |
tgtttgtttgcactgagatgagcacttgttgatatgattatatttattaatacatcttgttttaaatactctttttgcatattttactca |
7467941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University