View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19283_high_11 (Length: 215)
Name: NF19283_high_11
Description: NF19283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19283_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 26 - 196
Target Start/End: Original strand, 8173150 - 8173326
Alignment:
| Q |
26 |
ttgaggctcatgatgccataacaaa-----caaatagaagtgtgagaatagattgagaaaaaatatttgaacaatgagcgacaatattttgatttctcat |
120 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
8173150 |
ttgaggctcatgatgccataacaaattaaacaaatagaagtgtgagaatagattgagaaaaaatatttgaacgatgagcgataatattttgatttctcat |
8173249 |
T |
 |
| Q |
121 |
ctaagtgatatgtggcatcatatatgtatttaaagtgatta-tttatagattatgcttatttgaacaacgcacatga |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8173250 |
ctaagtgatatgtggcatcatatatgtatttaaaggggttattttttagattatgcttatttgaacaacgcacatga |
8173326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 152 - 196
Target Start/End: Complemental strand, 30534595 - 30534551
Alignment:
| Q |
152 |
aaagtgattatttatagattatgcttatttgaacaacgcacatga |
196 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||| |||| |
|
|
| T |
30534595 |
aaagtgattatttttagattatgcttatttgaataacgcaaatga |
30534551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University