View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19283_high_5 (Length: 252)
Name: NF19283_high_5
Description: NF19283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19283_high_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 15 - 152
Target Start/End: Complemental strand, 7468388 - 7468251
Alignment:
| Q |
15 |
aaaatttcaagtcatctcaaaaccttaatattgaatgatataacgaaagcttggaggattttgttaatgtgaaaacgtgaatatggatagaatgttgacg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7468388 |
aaaatttcaagtcatctcaaaaccttaatattgaatgatataatgaaagcttggaggattttgttaatgtgaaaacgtgaatatggatagaatgttgacg |
7468289 |
T |
 |
| Q |
115 |
atgacgaattctaattttaattagttttgagtatcttg |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7468288 |
atgacgaattctaattttaattagttttgagtatcttg |
7468251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University