View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19283_high_8 (Length: 238)
Name: NF19283_high_8
Description: NF19283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19283_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 13 - 203
Target Start/End: Original strand, 17073474 - 17073664
Alignment:
| Q |
13 |
agtaattccattagttttggatcaaatatgagaaaaagtcatgtagctttgcagttactatctatatgatgatttaggcacttccagctgcagctttcat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17073474 |
agtaattccattagttttggatcaaataacagaaaaagtcatgtagctttgtagttactatctatatgatgatttaggcacttctagctgcagctttcat |
17073573 |
T |
|
| Q |
113 |
atttgtgctaattgaaatgaaattttttctgaaaatctatgcaattagggcgtttagacgagtttatgtaaaacttatttcgacttatcca |
203 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17073574 |
atttgtgctaattgaaatgaatttttttctgaaaatctatgcaagtagggcgtttagacgagtttatgtaaaacttattttgacttatcca |
17073664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University