View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19283_high_9 (Length: 229)
Name: NF19283_high_9
Description: NF19283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19283_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 30393968 - 30393765
Alignment:
| Q |
1 |
aaaatccgcatggcagcagttttattctctggtagcttttaaaacacggtaactcatacatacaatttaggatgtgaactttggaattctgtatatatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30393968 |
aaaatccgcatggcagcagttttattctctggtagcttttaaaacacggtaactcatacatacaatttaggatgtgaactttggaattctgtatatatat |
30393869 |
T |
 |
| Q |
101 |
agttacacacaaatttagttaccatttgaaagctatggtagg-----aatgagacaacttttttaattagtaaatataatatatgactctaacaaacctg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30393868 |
agttacacacaaatttagttaccatttgaaagctatggtaggaatggaatgagacaacttttttaattagtaaatataatatatgactctaacaaccctg |
30393769 |
T |
 |
| Q |
196 |
tcag |
199 |
Q |
| |
|
|||| |
|
|
| T |
30393768 |
tcag |
30393765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University