View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19283_low_12 (Length: 201)
Name: NF19283_low_12
Description: NF19283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19283_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 1 - 180
Target Start/End: Original strand, 43211984 - 43212163
Alignment:
| Q |
1 |
agcacctccactaccatatccataaccagacccggatccagacccagacccggttccaaaaccatagccataacctctaccaaagccagaaggagaatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43211984 |
agcacctccactaccatatccataaccagacccggatccagacccagacccggttccaaaaccatagccataacctctaccaaagccagaaggagaatgt |
43212083 |
T |
 |
| Q |
101 |
cctgaacctgaaccgtaaccccacccacttcctggtgcagacccccatccccagctatagtcccaatttggaccgtggcc |
180 |
Q |
| |
|
|||||||||||||| || |||||||| || ||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43212084 |
cctgaacctgaaccatatccccacccgctacctggtgcagatccccatccccagttatagtcccaatttggaccgtggcc |
43212163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University