View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19284_low_5 (Length: 236)
Name: NF19284_low_5
Description: NF19284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19284_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 40980231 - 40980012
Alignment:
| Q |
1 |
tgtataatttagccaaaatcatggcaacgagcaacatggaaaaagagaaatttcattattattattaaataaaatacttggaagacaagacatacatgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40980231 |
tgtataatttagccaaaatcatggcaacgagcaacatggaaaaagagaaatgtcattattattattaaataaaatacttggaagacaagacatacatgtt |
40980132 |
T |
 |
| Q |
101 |
tgctttgtcgtgtttcccaaataattaattgatattaacatatctaannnnnnnngcctagaatatgatacacctattaactactcgtcctttgtaaaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
40980131 |
tgctttgtcgtgtttcccaaataattaattgatattaacatatctaa-tttttttgcctagaatatgatacacccattaactactcgtcctttgtgaaag |
40980033 |
T |
 |
| Q |
201 |
tatgcactataatcaaattgt |
221 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
40980032 |
catgcactataatcaaattgt |
40980012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University